Query (optional)   in Class  

GrainGenes Sequence Report: L44079

[ Printable Version ]  [ Submit comment/correction ]

Sequence
L44079
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
Keyword
STS
primer
sequence tagged site
Species
Hordeum vulgare subsp. vulgare
Data Source
genbankRelease 135, Apr 15 2003
Title
Hordeum vulgare (clone ABG64) chromosome 4H STS mRNA, sequence tagged site.
Strain
Steptoe
Clone
ABG64
Probe
ABG64
Remark
DB_xref: taxon:112509
Feature: source: mol_type = 'mRNA';
Locus Comment: Original source text: Hordeum vulgare (strain Steptoe) (clone:; ABG64) cDNA to mRNA.; Also published in the GrainGenes database 1994 (ACEDB derivative; for barley and wheat).
DNA
gcaggtagagagagagagagaggggtatgcatggacgtggtcgatgcagg
tcgatcggggtaggctaggcgcatgacgacggtcgactgctagcagctcg
agacagacgcagcagctgcatgcatgcatgcatgcgtctgagcattcgac
gcgacacatcagcatggtgactcgcgacatgtagacatgacatacttatc
gacactagtcatcactgacgaacgtcacacnnnngatgatcgtagacgtc
gagacgatcgatcgagtcagctgactacgtgaactgcatgtcagcctgag
tcgtacgcgtcatcacgatgcagagctctgcgtgatagccacgcatgata
cgtgctgtgcgtgctgtgcagcatgcaggctctgatccattcgttttgcg
ctgcacttcgcctgactgcactgcacaggccagagagggtagtacagtat
gagcggatgattcagcccggtgcaggagcgc
BLAST
BLAST Search