Query (optional)   in Class  

GrainGenes Sequence Report: M36941

[ Printable Version ]  [ Submit comment/correction ]

Sequence
M36941
Subsequence
M36941_1.cds4291472
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC173529
Data at Gramene
Gramene-Protein Q40055
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
Keyword
alcohol-soluble prolamin
hordein
seed storage protein
Species
Hordeum vulgare subsp. vulgare
Tissue
immature endosperm
Data Source
genbankRelease 135, Apr 15 2003
Title
Hordeum vulgare C-hordein gene, complete cds.
Strain
Bomi
Gene
Hor1 (Hordeum)
Gene Class
Hordeins
Gene Product
C hordein
Remark
DB_xref: taxon:112509
Feature: source: mol_type = 'genomic DNA';
Reference
ReferenceEntwistle J (1988) Primary structure of a C hordein gene from barley Carlsberg Research Communications 53:247-258.
EMBL Feature
mat_peptide4891469Location: 489..1469
polyA_signal15491554Location: 1549..1554
sig_peptide429488Location: 429..488
DNA
aagcttacaaacttagtcccactcagatatgcctatctggatatgactac
ataaagtagagcatcacaaactaaattccaaaaagaggcaagacctagat
tatgtgtgtagtgtaaagtaaaaaaaatgactcatcattcattatggatc
atgacttacaaccagatgatatttgcaaaaaaaacaactatgttgagcaa
tccaaaatcacacaagtaaagtagtaccaccaaacacaacataccaaacg
attagttggataatcttaggagtactttttcgaaaagcaaggcaaggatg
gaattaaaccataccatgatagctataaataaacatgcaccatcatggtt
accttccatcatccaaactttacacaccaagatcagaaacatctattcca
agcaagcaatagtaaccaaaaatccaacatgaagacgttcctcacctttg
tcctccttgccatggcgatgagcatcgtcactaccgctaggcagctaaac
cctagccaccaagagttgcaatcaccacaacaaccatttctgaaacaaca
atcatatctgcaacaaccatatccacaacaaccatatctaccgcagcaac
cattccccacaccccaacaatttttcccctatctaccacagcaaacattt
cccccatcccaacaaccaaaccccctacaaccacaacaaccattccccct
gcaaccccaaccaccacaacaaccttttcctcagccccaacaaccaaatc
cccagcaaccacaacaacctttcccccggcaaccacaacaaatagtaccc
cagcaaccacaacaaccattccctcagcaaccacaacaaccttttcctca
gccccaacaaccattctcttggcaaccacaacaaccatttctccagcccc
tacaactatagcccctgcaagcacaacaaccattccccttgcaacctcaa
ctaccatttccgcaaccccaacaaccaattggacagcaaccaaaacaacc
actcctgcagcaaccacaacaaacaattccccagcaaccacaacaaccat
tccccctgcagccgcaacaaccattcccccaacaaccacaacaaccactt
ccccaacaaccccaacaaataatttcccagcaaccccaacaaccattccc
tctacaacctcaacaaccattcccccaaccccaaccattcccccaggagc
aaccccaacaagcattccccctacaaccgcaacaaccattccccgaggaa
tcagaacaaataattacccaacaaccattccctctacaaccacaacaact
gttcccccagcaaccacaacaaccacttccccagccccaacaaccattcc
gccaactaccaaaatatataattccccagcaacctcaacaaccattcctt
ctgcaaccacaccaacctcagcaaccttatgcacaacaagacatctggag
tgatatagccctcttgggctaatgaagcgaaaagttgtaatactagatgg
gtgtatcatcgttgtttagtcagtgagtgttccagtgtattgatcatgaa
taaagtgatgtgcaccatcatgtgtaatcccgacctatactagttcaagc
atgagaaaaggacaagaagttgtcacaaggacaatgatggtaatttttac
cattcatgccatatttagatttttttccctcaactataatttgagtcata
tgcattatctacctatttatgaagtgaagccctatgagccaaacattatt
aatggttgtcaaacttggtttgaatttgattattagcaaataaggagtat
gaagtaattgcaaattatctcttcggtggctagtcgtatgaactgtgtga
cttgcaagttattcaaatggttcctttaatggaccggttgctcatgttag
aaaatatgggcttgcgccgtattgatttcttgcaaatggacaatatgaag
ggtagattgaatttattccttctatttctcctccacatgtattacgagtt
acttagagaagttccaccagactgatatggtccacttggtatagctaccc
aatggtcggaagctt
BLAST
BLAST Search