Query (optional)   in Class  

GrainGenes Sequence Report: M55449

[ Printable Version ]  [ Submit comment/correction ]

Sequence
M55449
Subsequence
M55449_1.cds5444043
M55449_2.cds53627641
M55449_3.cds53627308
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC155430
Data at Gramene
Gramene-Protein Q40073
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
Species
Hordeum vulgare subsp. vulgare
Cultivar
Sundance
vulgare
Tissue
leaf
Data Source
genbankRelease 135, Apr 15 2003
Title
Hordeum vulgare subsp. vulgare ribulose 1,5-bisphosphate carboxylase activase (RcaB) gene, complete cds; and ribulose 1,5-bisphosphate carboxylase activase (RcaA) gene, alternatively spliced, complete cds.
Clone
lambda-BRca-1
Probe
HVM3
HVRCABG
Gene Class
Ribulose bisphosphate carboxylase activase
Gene Product
ribulose 1,5-bisphosphate carboxylase activase
ribulose 1,5-bisphosphate carboxylase activase isoform 1
ribulose 1,5-bisphosphate carboxylase activase isoform 2
ibulose 1,5-bisphosphate carboxylase activase isoform 2
Remark
DB_xref: taxon:112509
Feature: source: mol_type = 'genomic DNA'; tissue_lib = 'lambda-Charon 32-Murray library'
Gene: RcaB
Gene: RcaA
EMBL Feature
TATA_signal267273Location: 267..273
[ Show all 8 ]
DNA
accgtcgacgccgttgtgtagagacgatggagccaatcctcagcgtgtgg
ctcctgggagatgcccaaccctatccacacaattaacatctcatcatcca
ctccacttggctcgcctcactagctacttatcgcagccggcctgataatc
acagcttatgtggcttgactgcgtgattacgcagggacgctctagaatag
tctctcacgctctaggtcactccagtcgtgttggacgcttgctccatggc
catctgtccatgcacctatataagacgccatggccaagctccatcgatcg
gcatcgcatctgtacctgctaaccactgcacccctctcttttatccatat
cagctccatccatcactgacgatcgatctcagtccacctgcatctgtagg
tgtactagtagtacgccggcctaatccagctgagagctgatcgagctagc
ttgcatataccactgcacgtacgcacatcaaattaattagaaactactgt
aattaagttatcagcagcgagaagagaacgatcgatcaacaccatggctt
ctgctttctcgtccaccgttggagctccggtacgtatgacctacacttcc
acgtacactcgtggttcctaatccttaattcagtggacacaacgtgtgta
cgacaaaaagaaaactcaccgtctctctaaattaattgacagagttgcta
cacattttcaggtctgaattgtttcattttgtacagtttttaatataatt
tgtgaccgtgtgatcttgctttgagattcggacgcgacaagctgggcctc
ctctctatgtgttgactccgacaagggcatctctttcctcacccatgcct
tccggggcttaaaaagactgtctatggtcagcctgagcgttcgggtattt
tggttatttcggttcatgtgtaattcgggtattaaaaaaatgggaatcgg
aattttttatgtcaaaaaaataaccgaacccaaattacccaaaattttgg
tttgggtaactcgggtacccaaaaaacccaaaatattcagagcacacatt
aagtttcggcatgaataattcagatagtgtgggtgttttagttagtttgt
gtaacatgtaagtgtaataataacataaataatttgactagtatgaataa
ttcgggtagtatgggtattttgggttttacagactagaacctgaacccta
acccgaaaaccgaatagccaggaaatgagaaccaaaccttaacccgatac
ccatattacccgacaattcgggtattttggttcagttcgggtttgggtag
cgggttagggtatccaaactctcgggtgagtctagggtgatggggtgggc
agcggatggctagccaccatggggcgaaggctatcaaatgaggtcatttg
atctcggtttgggcatgaccttgaatattgagttagcacgataaagataa
tttaggcaatactaatggttgtttcatgatggcgcggatgagaatgaacg
ggaggtggtagcgagattttatttaggagcaactattgtgaggtttatta
aatcacgatgcaaattacaaatagggcgaggtgagggtggtgaccgggga
gtgttgagaaatgtgggaagctaatggttacactttttcgaagctattgc
gtggaggaggaagggaaagatagaacctcaaaagtctcgagtggaggcac
acggttgtcaagcccgtgtgtgagaatttgagtgacatatagatttttaa
ccggttcttctttgtctcttgccttcaagaagggactggatgaggatgaa
actactagatgtagatcagatgacctttaaaagaaaagtgaatggccgat
atgaaggagggagagagagagagggaagaaagattgaagttagatacaat
aatattagaaactaactagtgaagtatgcttctcctcattcttcattagt
aagaacttttggctgaattagttactccctccgtctcagtgtataggtca
tattaggttgtgcatcgtgatcaaaacggagaggaaaacaaaaaaatata
ttaatttgctaattaatatcattgcatgtaatgaattaaccactgcatgt
cgtgctagttagtcgcaagtcattaaaaacatacacgttccatgtctctt
attggttgattcctttatccatgtaaaaaaaaacaaaaaacaagcagaaa
attaatgcatcgtgcctaagtgttttgagatttttttttcataagatgac
ttataaaccaagacggagggagtaggttgttttgtaattcaatatgtcat
tcaagccatggggcatcaacttcaaggcccagcatgccgggacgggacgg
atctaaaaactattttgactcgtggcaaaacatcattaaaataagggagg
taaatgatggagagtaacaaaaacgatttaagagtggtgtcacattttat
ccaaattcattgagttttagcatttcctcctaaaagttattcaaatcgta
ttgaaatttcatattttgagtagggtcctaggcccccactctcttcaaca
cgggcccaccacttctggtattgtacctttgaccttccgcccctgttcat
cagctggagcttttggatggactaattaattctatatatatgcggatgca
attgaatagcgagtgaagtctggaactgcccaaatgaagggttgatatct
gcaaattaagcgttcatcgtggcaattgctattgaaagcaagcagcaagt
gaaccaacgtgcatgaatgtgattggggctgactatgtcatacttgtgca
ggcgtcgaccccgaccatcttcctgggcaagaaggtgaagaactactacc
atggtggcaacaagatgaagagcagggtggtgagggtcatggcggccaaa
aaggaacttgaccagggcaagcagaccgatgcggaccggtggaagggtct
ggcctacgacatctcggacgaccagcaggacatcactcgggggaaaggca
tcgtggactccctgttccaggcccccatgggcgacggcacccacgaggcc
atcctaagctcctacgagtacatcagccagggcctgcggaagtacgactt
cgacaacaccatggacgggctgtacatcgcgccggcattcatggacaagc
tcatcgtccacctcgccaagaacttcatgacactccccaacatcaaggtt
cctctcatcctgggtatctggggaggcaagggacagggcaagtcgttcca
gtgtgagctggtgttcgccaagatgggcatcaaccccatcatgatgagcg
ccggtgagctggagagcggcaacggcgagccggccaagctgatccggcag
aggtaccgcgaggcggccgacattatcaacaagggcaagatgtgctgcct
cttcatcaacgacctggacgccggcgcgggccggatgggcgggacgacgc
agtacacggtgaacaaccagatggtgaacgccaccctgatgaacatcgcg
gacgcgcccaccaacgtgcagctcccggggatgtacaacaaggaggagaa
cccccgcgtgcccatcatcgtcaccggcaacgacttctcgacgctgtacg
ctcccctgatccgtgacgggcgcatggagaagttctactgggcgcccacc
cgcgaggaccgcatcggcgtgtgcaagggcatcttccgcaccgacaacgt
cccggacgaggccgtggtgaggctggtggacaccttcccggggcagtcca
tcgacttcttcggcgcgctgcgggcacgggtgtacgacgacgaggtgcgc
aagtgggtcggcgagatcggcgtggagaacatctccaagcgcctcgtcaa
ctccagggaggggccgcccacgttcgaccagcccaagatgaccatagaga
agctcatggagtacggccacatgctggtccaggagcaggagaacgtcaag
cgtgtgcagctcgccgacaagtacctcagcgaggcggcgctcggccaagc
caacgacgacgccatgaagaccggtgccttctacggcaagtagaaggtcc
tactctacttaagatcgatgcatgcactatatatatgttggactattttg
gacccgaaatccactcaaactttttgattcatcgccgcacaggtaaccca
attgtaagtctcttcttgaaagagaaggaattgtatatgttcttaaatcg
tcattttccgcttaatcatttctccaatggatgcaagctagggtcccaag
tcccaacaacctatatatctcttgatattagcacttgtcggaagattagc
acatatgtggaaatcatctgaagcttgttgattaggtacgagtactgtgg
atgtggggggtcatgactcatcacatacatacatattttccctttgacgg
attacggaaaccccaatttgcaccacaaagttgattaacaaggacaacat
cactagaaggtgtattggacaaagattgcatcgcaaacggctcgcattca
tcgtaatgatcaattaatggtctgtactagaccaaacaatgagaatacca
gcgggaacttgagctaggcaacacgaattacatttacatgaaaacattag
acacgttctataatcttttcatcaaagcaaaactgcatggctaccttttc
tcttaatacgcttcatttttttttaccgaagtggcaatatttattggagt
agacaaaagtacaaaccatgtgcttgatgtcaaccaggacttgatttgtg
tggtgccaaatgacatccctagcttgatggttatcaacaaaccagtatat
gtatggcagcaacaaatttgtggtacttggaactagaatacaatcttggg
tgcctcatccaacaagcaacgagagaccctttttttgtggttatgcaatg
acatggcttggctaataaacaagatagtatatacgggcgaccgagtgaaa
ggaaaaaatgaaaggcacggaagaaatgggagatgatttgagcatgaatg
gttagattctgtggccgtggaaggccatggaattgatggccagcagacgt
atctgcagctgcagctgcagcgtttggtcttgacggtccaagtcatccaa
ccggccggccaagacgctcagaacccaatctccagcgtgtggcctctggg
gatcgggaggctgatccacaagcaggggtgtgtgtatgccgcctcctcct
ccaagctccccacagcagagcagcaatatgccaatccacgtgtatttaag
gcgtcacatagctcggcctctatactttgagcagcagcagtattcatcac
tgatcaccagcacagccgcgcgcatccaccgttgtagcaaggtcgaccaa
gcagcacagagatggctgctgccttctcctccaccgtcggggctccggtg
cgtaccacacactgatcgatcgattgattgattgcatctcttgcttagtg
atgatatcctatcagtgtcttcagcggcatctcatgtgtgtatatgtaat
gtaatgtaatgtatacaggcttctacgccgaccaacttcctcgggaagaa
gctcaagaagcaggtgacctcggccgtgaactaccatggcaagagctcca
aggccaacaggttcacagtcatggcagcggagaacatcgacgagaagagg
aacaccgacaagtggaagggtcttgcgtacgatatctccgacgaccagca
ggacatcaccagagggaagggcatcgtggactcgctcttccaggcgccca
cggggcacggcacccacgaggccgtcctcagctcctacgagtacgtcagc
cagggcctgcggaagtacgacttcgacaacaccatgggaggcttctacat
cgctcctgctttcatggacaagcttgttgtccatctctccaaaaacttca
tgaccctgcccaacatcaaggtacctttttttttcttttctttttttgaa
aaaaggaggttgaattaatcgatgcatgcagacatcgttatttaatttaa
ttgattattagcagaagcagcaataaaatgaatcattctgattctgaaac
tgaccttgaatcgaaattcagatcccactcatcttgggtatctggggagg
caagggtcaaggaaaatcattccagtgtgagcttgtgttcgccaagatgg
gcatcaagtaagaatttacattcatctacttcctccctaaagaaatacta
ctccctccgttccataatataagtcattttagagatttcactaaggacta
catacggatgtatatagacatactttagagtgtagattcattctttttgt
tttgtatgtagtttcttgatgaaatcgcttaaaagacttatatttaagaa
cagagggagtataagataatagtaataatagataatgacctgtgcttttt
gccacagccccatcatgatgagtgccggagagctggagagtgggaacgct
ggagagccagccaagctcatcaggcagcggtaccgtgaggctgcagacat
gatcaagaagggtaagatgtgctgcctcttcatcaacgatcttgacgctg
gtgcgggtaggatgggcggaaccacgcagtacaccgtcaacaaccagatg
gtgaacgccaccctgatgaacatcgccgatgcccccaccaacgtgcagct
ccctggcatgtacaacaagagggagaacccccgtgtgcccatcgtcgtca
ccggtaacgatttctcgacgctctacgctcctctgatccgtgatggtcgt
atggagaagttctactgggctcccacccgtgacgaccgtatcggtgtctg
caagggtatcttccagaccgacaatgtcagtgacgagtctgtcgtcaaga
tcgtcgacaccttcccaggacaatccattggtatatttctcttgtttcca
aatatatatatatatatatatatatatatatatatatatatatatatata
tatatatattcatcaggcagacaagttgtatatcagtaattaacaaagta
tcatgcatcgatccgatacagactttttcggtgctctgcgtgctcgggtg
tacgacgatgaggtgcgcaagtgggtcggctctaccggaatcgagaacat
tggcaagaggctggtgaactcgcgggacgggcccgtgaccttcgagcagc
caaagatgacagtcgagaagctgctagagtacgggcacatgctcgtccag
gagcaggacaatgtcaagcgtgtgcagcttgctgacacctacatgagcca
ggcagctctgggtgatgctaaccaggatgcgatgaagactggttccttct
acggttagaaaattctccatacacacccaccatctcttgctgcataggag
gaggtgaactacgcacaatcttcttatactttcagcaactactttacatg
catacttctttctcactttcttacttcggaaaaaaaaagggagtggaggc
ctgtttttcttacctgctcttccgccggcatatcaagctcatcttctcat
cacgtccaaaacaattaaattcgaggtaaaggagcacagcaaggtacttt
gcccgtgccggaaggttgcaccgaccaaaatgccaagaactacgacccaa
cggcaaggagcgacgacggcagctgcctttacaccttttaagcatgccac
ttttaatatctgatgttttacctacctaagtccgcatcgcatccaagcga
ttgctgggcatgttttgttaatatatctctaaatatattgtgtataccca
tttggcaaagaccaatacacctacttatcatttgtcactctcagtattca
ttccttcagtggagactccttctgctttgttgcaaacagaacaagaaagt
attaatttgagcttcagcttattaattattattgcacaaacgcatggaaa
ctgagagtcaattgcgatcatgcgatacatacagcgtgtaattttagccc
tgatgttccaacgtccaaattagatccccaaaactaaacgtcatttaagc
ttagaaagacaaacagaaaggagcagttgtttcaaatgattgctgtggag
aactacatccttaataagcagctgcatcatgatgtggttccctaagagca
tctccagccgttcgatcttccggggcgtaaaatagcgcctcctggaggcg
tcggcggaaaaatcgacgtggaggctcgggttcccagccgtcccccaagg
tcgcccccacccgctaatttctgcacattttcggtgctaattggcccact
ttcagcgcaaattggttcactttcgacgcaaaatgagaccaattttgatc
catatgcagcatgctttaacacaaattaaacaaatcatttatttttctat
cacatagttcatcacagaaatcaatacaaatcaaaaatagtttaacaaat
caaaatagttcaacaaataaaaactcataattcatcacacatcgagctag
gcgttgcccttaagcctccataggtactccaccaaatcggtttatagttg
ttgatgcacctgtgggtctcgaatctcctgacacatgttgatgaaggcac
tcgaagttgccggtagctggtgatcaacttgggcaaggggaccctgcctg
taatatggttcaatgtcaaagacgggctcttcccgctcgctctcaatgtt
catgttgtgcaagatgacacaccaagtcatgtcttctcacatttgatctt
tcgaccacgtctgagcggagtatcgaacaatagaaaaacgagattggagc
acaccaaatgctgcgt
BLAST
BLAST Search