Query (optional)   in Class  

GrainGenes Sequence Report: MLOC_2075.1

[ Printable Version ]  [ Submit comment/correction ]

Sequence
MLOC_2075.1
Locus
MLOC_2075.1
DNA
GAGTCGCTTCGAAGATCGACACCAGTGGAAGTTTCTTCCGGTCCCAGAGA
GATCGCGGAGGGGAGGAGGATGACGGGAGGGCGCGCGGTGCTCCTGCTGC
CGCTGCTGGTGATCTCGGCGCTGTTCGCGCAGATCAGCGCGTCGGATCCG
CTGTTCCACGAGTCCTTCGACGAGAGCTTCGACGGGAGCTGGATCGTGTC
CGGCAAGGATGAGTACAAAGGTGCATGGAAGCACTCGAAGAGTGATGGCC
ATGAAGACTATGGCCTCCTTGTTAGTGAGCCAGCCAGGAAATATGCCATA
ATCAAAGAGCTTGATTACCCTGTTACTTTGAAGGACAAGACAGTTGTCCT
GCAGTTTGAAGTGAGGCTTCAGAATGGCCTTGAGTGTGGAGGTGCTTATA
TCAAGTACATCCGTCCTCAGGCTGTGGGATGGAACGCCAAGGACTTTGAC
AATGATACTCCATACACAATTATGTTTGGTCCTGACAAGTGCGGTTCAAC
AAACAAGGTTCACTTCATCCTGAAGCACAAGAACCCTAAGACTGGCAAAT
ATGTTGAACATCACCTCAAGTCCCCGCCCTCTGTCCCATATGACAAGCTC
TCTCATGTCTACACGGCTATCTTGAAGCCGGATAACGAGGTCAGAATTTT
GGTTGATGGGGTGGAGAAGAGCAAAGCAAACTTCCTGTCTGCTGATGATT
TTGAGCCAGCACTTATTCCATCAAAGACTATTCCTGATCCCGACGACAAG
AAGCCAGAGGACTGGGATGAGAGAGCTAAAATCCCTGATCCAGATGCCGT
GAAGCCTGATGACTGGGATGAGGATGCCCCAATGGAAATTGTGGATGAGG
AGGCCACCAAGCCTGAAGGATGGTTGGATGATGAGCCTGAGGAAATTGAT
GATCCAGAGGCTGCTAAGCCTGAGGACTGGGATGATGAGGAGGATGGCGA
ATGGGAGGCACCGAAGATGGACAACCCCAAGTGCGAAGAGGCACCTGGAT
GTGGTGAATGGAAGAAGCCAATGAAGGATAACCCTGCCTACAAGGGCAAG
TGGCATGCACCCCTGATTGACAACCCCAACTACAAGGGAATCTGGAAGCC
CCAAGAAATCCCCAACCCTGAGTACTTTGAGCTTGACAAGCCTGACTTTG
ACCCAATTGCTGCTATTGGAATTGAGATCTGGACAATGCAGGATGGCATC
CTGTTTGACAACATTCTTATTGCCGATAATGAGAAGGTAGCCACCTCTGT
CCTGGAGAAGACATGGAAGCCCAAGTTTGATGTTGAGAAGGAAAAGCAGA
AGGCTGAGGAGGCTGCAGCAGGTGCATCAGAGGGCCTTTCTGAGTTCCAG
AAGAAGATCTTCGACATTTTGTACAAGGTCGCAGACATCCCGTTCTTGGA
ACCATACAAGACCAAGATCATTGAAGTGATTGAGAAGGGAGAGACGCAGC
CGAACATTACAATTTCGATTCTGGCCTCCGTCGTTGTCGTCATTGTGACT
GTACTCTTCAGAACCTTGTTTGGTGGCAAGAAGCCAGTGGCACCTGTGAA
GCCCGCTGCTGAGACCAAGAAGCCCAGTGCTGTTGTTCCTGATGCCACCG
CTGGAAGCAGCGGCGACAAGGAGGAGAAAGAGGACGACAAGGATGCGCCA
CGCCGAAGGTCGCGAAGAGACGCATAAACTAACTCTTGGTGCCTTCGCAT
TTTGAAGGACTCGGCTCTAGCCTTTTTGAGAACGCCTCGAGTGTATAATC
GAACCCTCTGCTGCTAGTAGCAACCTCTAGTTTTTAAGTCGCTAGAAATT
TACGAGCCGGCGAAGCTCGTGTTGATCGGTTGTTTGTGTGCTGTTCTGAA
TCAGCTAGAAGAGACTGTTTTATTTTTCCTTTTCTTTTGTTTTATATCAG
ATGAAACATGAAGCTTGTGTTTGGTTGTTTGTGTGCTGTGCTAAATCAGG
TAGTCCCTCCGATCCAAATTAGCTGATTCCGTAGAAACCATTTACTATTG
TTTTTATTCACTTGACCTGGTTAAATCAGAAGCGAGCTTTTTGGTTCC
BLAST
BLAST Search