Query (optional)   in Class  

GrainGenes Sequence Report: MWG2013-3

[ Printable Version ]  [ Submit comment/correction ]

Sequence
MWG2013-3
Data Source
Kuenzel, Gottfried98.05.05
Probe
MWG2013
DNA Homology
R15753100noncereal_EST
[ Show all 72 ]
DNA
gggatccagtactcgcagctgcatgggcacgccgctctctgctccgacca
cgccgaactccggccatgctgacgctttttgatcctccagccgagaccac
cggctcgccgtgctcctctttctcctctccctccaccttgcaaccgccat
gcgcaggtttcaactcatccatctcctcctcttcctcctcctcctcttcg
tcacagtcgtggccatcatctagatcttcctcctggccctcctcttccat
gatgtcatcatcgcaagatccaccaaccggcaagccgatattcagatcca
cgccaggccccagcaccccggccgcaccgctcatgatctcttccttga
BLAST
BLAST Search