Query (optional)   in Class  

GrainGenes Sequence Report: MWG2021-3

[ Printable Version ]  [ Submit comment/correction ]

Sequence
MWG2021-3
Data Source
Kuenzel, Gottfried98.05.05
Probe
MWG2021
DNA Homology
W21732201corn_EST
[ Show all 126 ]
DNA
ctccactttgacatcaagcctcacaacatcctgctcgactacaacttcaa
cccaaagatctcagactttgccttgccaagttgtgcgcgagggaccaaag
catcgtcaccttaaccgcagcaagaggcacaatgggctacattgcaccag
agcdatattcccggaactttgggggagtatcgtacaagtcggacgtgttc
agtttcggcatgctggtgttagagatggtgagtggaaggaggaactcaga
cccaagtgttgagagccagaacgatgtttacctcccggagtggatctacg
agaaagtgatcaacggggaggagttggcgcttactctggaaacgactcga
gaagagaaagagaaggtgaggcagctggcgatggtggcactgtggtgcat
ccagtggaacccgagaaaccggccgtcgatgacaaaggttgttaacatgc
taacagggagg
BLAST
BLAST Search