Query (optional)   in Class  

GrainGenes Sequence Report: MWG2053-3

[ Printable Version ]  [ Submit comment/correction ]

Sequence
MWG2053-3
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
Data Source
Kuenzel, Gottfried98.05.05
Probe
MWG2053
DNA Homology
AA049425117noncereal_EST
AA137649117noncereal_EST
AA789945117noncereal_EST
AA137477117noncereal_EST
MMHC135G15121noncereal_BlastN
DNA
cctactgtttgtgaatcctgagatgttaatgccaggcaccagaagaaacc
tcttcacggccgcctatgatgaattgaaggacatcgtcgcgaaaacagat
ggcatcatcttcgaaggatatgaggagatagggcttacacagatgataat
tg
BLAST
BLAST Search