Query (optional)   in Class  

GrainGenes Sequence Report: MWG2065-5

[ Printable Version ]  [ Submit comment/correction ]

Sequence
MWG2065-5
Data Source
Kuenzel, Gottfried98.05.05
Probe
MWG2065
DNA Homology
AI106393133noncereal_EST
[ Show all 61 ]
DNA
cagcgccgtggacgggagcacgagggagacgttgttcacggccgccgcga
actgcgtgccgttgggcccctggcacgtcatgttcttggggcacgggagc
gtgccagatggtgaagaagaagcgcctgtccaccgactgcggcacggccg
ccgggtactgttttgtggcgaggctgcggagcttggtcgtgaagttggtg
acgaagttggtgtcgttgtagtagggcagcatcggcttgaagatgggcaa
ggccttgttcgaagcttgcacgaagagggcgagccggggttgcggtactc
gaggatgccggcgaacgg
BLAST
BLAST Search