Query (optional)   in Class  

GrainGenes Sequence Report: MWG2067-3

[ Submit comment/correction ]

Sequence
MWG2067-3
Data Source
Kuenzel, Gottfried98.05.05
Probe
MWG2067
DNA Homology
C73647115rice_EST
[ Show all 14 ]
DNA
gggaaggtgaggtaaatctgccgggaccccgggttcatcatgctggcgaa
gtcgccgcggtcgagacgggggcggttcatgaacttgtgvgcctcgtcgc
cgcccagcatcaacgccgctgcggcagcgcggccgcggccctgcgaatcg
gagagtaaccggtgagctgccggccggtagaaacgagagcgaggagctcg
taggtggcgagggtggtgggtatttacctttggccgtcgttttgctgctg
ctgctgctg
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.