Query (optional)   in Class  

GrainGenes Sequence Report: MWG2138-3

[ Printable Version ]  [ Submit comment/correction ]

Sequence
MWG2138-3
Data Source
Kuenzel, Gottfried98.05.05
Probe
MWG2138
DNA Homology
AA754158140rice_EST
[ Show all 89 ]
DNA
accaagccggtctaccccggcgccaacttctacatgttggcccggcccta
ctccaccatcaggcccggcaccttcgacaactccaccgtcgccggcatcc
tcgagtaccgcaaccccggctcgccctcttcgtcaagcttcgacaaggcc
ttgcccatcttcaagccgatgctgccctactacaacgacaccaacttcgt
caccaacttcacgaccaagctccgcagcctcgccacaaaacagtacccgg
cggccgtgccgcagtcggtggacaggcgcttcttcttcaccatcgggctg
gcacgctcccgtgccccaagaacatgacgtgccaggggcccaacggcacg
cagttcgcggcggccgtgaacaacgtctccctcgtgctcccgtccacggc
gctg
BLAST
BLAST Search