Query (optional)   in Class  

GrainGenes Sequence Report: MWG2162-3

[ Printable Version ]  [ Submit comment/correction ]

Sequence
MWG2162-3
Data Source
Kuenzel, Gottfried98.05.05
Probe
MWG2162
DNA Homology
C03724144noncereal_EST
[ Show all 84 ]
DNA
tcgtgttgggcatctacggcttcatcctcgtcctgcatggcctcatcaac
agcctccccatccactggctctcctggtttgggcaactcggcgctttctg
gaacg
BLAST
BLAST Search