Query (optional)   in Class  

GrainGenes Sequence Report: MWG2190-5

[ Printable Version ]  [ Submit comment/correction ]

Sequence
MWG2190-5
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
Data Source
Kuenzel, Gottfried98.05.05
Probe
MWG2190
DNA Homology
BNAESTF641397noncereal_EST
[ Show all 621 ]
DNA
gagctcggtacccgggaatcgtggtactgaactgcgagcaaaatgactag
tgacactgactcgtaacatggtgtcaaagagtggtagttccatgccaatt
aacyccatatctgccagagaactatgaggagcacttcaggcgagacacaa
gagtccagcccaacaggtgatggggtgagctagagattttgataccctgg
tagtgtggttaggccgagctagtgacaattctaagaggcaaccggatagg
tgatgaagaggtaacctctgactagcatgtacatcacagatagagagcgt
caagagcaatttccttgtggtgtagattggaccgagtgtcgagccttcct
ctaaagagtaggcaaacatatattgttagtttttgtggggatcttgagcg
ccagattagaggtgtatggtcgtcctgtttcatcgtcatgcatgacgatg
tcataatctataccttcgaggagaagttggatccatggaaaagatcctct
agagtcgacctgcaggcatgcaagcttttgttccctttagtgagggttaa
tttcgagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgt
t
BLAST
BLAST Search