Query (optional)   in Class  

GrainGenes Sequence Report: MWG2230-5

[ Printable Version ]  [ Submit comment/correction ]

Sequence
MWG2230-5
Data Source
Kuenzel, Gottfried98.05.05
Probe
MWG2230
DNA Homology
R34352137noncereal_EST
[ Show all 8 ]
DNA
aaacttaacgtactctaggccaggaggccatgcagctacgcgggactaac
tgatcaatgatgttgctttcctgtttgctcccagtacgtaccagtatata
ctctaccccgtaggccataccagtyttgataacgtcgtccggcgcctacg
cctacgggtggctgtgcctgtcagcagtacaaaaaaaggcgatagcagca
ttaaggggaatattgaagccatggctgagcttgagctggggcgccagtgc
tgccgtttccttgatctggagttgtggtacgtacagctagcaggtactag
ccacgtattgctcggcagtaaaacaattcaaagctgcacgccatcatcat
ctgttgcatgcatgctactaccactg
BLAST
BLAST Search