Query (optional)   in Class  

GrainGenes Sequence Report: MWG502-5

[ Printable Version ]  [ Submit comment/correction ]

Sequence
MWG502-5
Data Source
Kuenzel, Gottfried98.05.05
Probe
MWG502
DNA Homology
AI119433150noncereal_EST
[ Show all 121 ]
DNA
cagcaatcgaaacccatgtttgcatcctgatatcaagatgaggaagctga
tgcagttgcgggccataattaaagcgatatgtaactaagtaaatggtcga
gcgatatgtaactaattaatcggcgtgagaagtttcatggtggcttgttg
gtgaagacacacgcgtggattggctgtcaattagtttttcagaccaagag
gagtttccctgcgagatgtgggcccgtct
BLAST
BLAST Search