Query (optional)   in Class  

GrainGenes Sequence Report: MWG526-5

[ Printable Version ]  [ Submit comment/correction ]

Sequence
MWG526-5
Data Source
Kuenzel, Gottfried98.05.05
Probe
MWG526
DNA Homology
N22162137noncereal_EST
[ Show all 138 ]
DNA
canbcgagaaatcaaagaaaatgcttcaaagagctatttcttcaaaggtc
aactattcatcactgtcacagtctgagaatgaacataacatgccatccta
ctttctgagtggctcatcgtattgcactccaacccaaaatccatgtccaa
gggattcagctttgccaacaaattatacagcgcccctcttgtcacctggc
tcaacttcacatctatctcccacctattgcaaatgttaatattaaatcta
aaaatattacataataaaacggatacatctttcatttcatgctacagaag
aagaaagctttcacctgtatttcagattgtccatttcaatagcaaagaag
cagtatttactaaatacctctgaaagcagagtaccttaataataagttaa
ttatcttggtagaatttcctactgattgtcaacttattgaactataacac
ttgttgacagtcatattttacgagaagaattactactgtggctttagcta
ttagaaggaaatatacactgcaatactcacaatagttgcaatgttccatt
catatgcaca
BLAST
BLAST Search