Query (optional)   in Class  

GrainGenes Sequence Report: MWG533-5

Sequence
MWG533-5
Data Source
Kuenzel, Gottfried98.05.05
Probe
MWG533
DNA Homology
C74867148rice_EST
[ Show all 237 ]
DNA
tgtccgccgccccctgcgccgcgcgtcccactcccggtgagagcaggcgc
cgatcgagccggcgcgatcaagatctgtcatacgtgatctgacgtgtggt
tttacggacgatgtgcagacggcggtggagccgagcgacctgaggagccg
ggggctgtgcctggtgccggtctcgtgcagcgaccgcgtcgccgccgtcg
acgtctgctcgttggtggcggcgatgaggttgacggctggggaggaggag
gaggacaccgaggctgccgttgcgatgctc
BLAST
BLAST Search