Query (optional)   in Class  

GrainGenes Sequence Report: MWG571-3

[ Printable Version ]  [ Submit comment/correction ]

Sequence
MWG571-3
Data Source
Kuenzel, Gottfried98.05.05
Probe
MWG571
DNA Homology
AA446580124noncereal_EST
[ Show all 30 ]
DNA
cgctctcatactccttccgctgggatggcgcttagcttttttgtggctgg
gtcccgtcggcaatcttctaattttcgctctttagcgatgattgtgcccc
ccggcggcggcggcgcgcttctccagaatgggaggggagcgcaggttcgg
ctgccgtttacgctgccgtgttggacgatacgggctttttctcgatttcg
cccctgacgttttgggatttca
BLAST
BLAST Search