Query (optional)   in Class  

GrainGenes Sequence Report: MWG571-5

[ Printable Version ]  [ Submit comment/correction ]

Sequence
MWG571-5
Data Source
Kuenzel, Gottfried98.05.05
Probe
MWG571
DNA Homology
RICS15170A141rice_EST
[ Show all 49 ]
DNA
caggcatccaaaattcggcaaaattcacggccaggacggggcggaacagg
gcgctgccagcaagtagatctctctacctgtcagaagagcagtacctgat
caagaacgggagaaggaggggccggggatttcgcggaacgccagagaact
cgaccgggatcgatcccgcgaagagccgggcgcagattcggtgcgcgcct
ggccgccttgcaagcttgctgttggtggattctgggatttct
BLAST
BLAST Search