Query (optional)   in Class  

GrainGenes Sequence Report: MWG599-5

[ Printable Version ]  [ Submit comment/correction ]

Sequence
MWG599-5
Data Source
Kuenzel, Gottfried98.05.05
Probe
MWG599
DNA Homology
R00262121noncereal_EST
AA932720119noncereal_EST
AA091172118noncereal_EST
DNA
ttgatctagcagcgaaacctggcctggcaattgcgtgtgatataagacgc
tgcgtgagtctttggacaacgcaacgctctcgacatcacgaattgtgctt
gtaaagccaacagtaagtcaagacgtcaaacacttatgatcagagtctgc
aatgtcgtggaaactcgaggttttcttcgtcgttatgattggtggctgtg
aaagtaacatcgatggaacagcttctgcaagcaggatctgggaatctttc
taactggcagcggcaggagccagccactgcctgtctcatggttcggcttg
actcgcatgacagtccg
BLAST
BLAST Search