Query (optional)   in Class  

GrainGenes Sequence Report: MWG632-5

[ Printable Version ]  [ Submit comment/correction ]

Sequence
MWG632-5
Data Source
Kuenzel, Gottfried98.05.05
Probe
MWG632
DNA Homology
N37959226noncereal_EST
[ Show all 27 ]
DNA
aaagtaaatgagaactttaattacaaggatggaatgaagtgaggtgggtc
tcgtcaaacaaacacttaacaaacacttaacaaaggaaagctgaaaatca
cgcagaaagctggtgagcatgatgcgcacctgtgcagaatctgagatcaa
cagcagcacaaggtcgctgcctgaaactgtctcccatatgtcccccaatg
ttccgtcctcctcagtgaatccagcaccacgtgcttcctcaaaagacttg
gaacctttcctgagaccaatctgaaaccmaaaagacacagcctatttgaa
caactgacatttatactgccaaagtacatactaccaaatggcgcagaata
taagctgtcacataatttgcatattccaatttgtatagcaccaaattttc
actttaagcaagaacaagtgataaaacagtgcccggtgcaagttattata
aagctgaagaaaacaataaacattagctgtgggtgttcactcagggctgc
aagcmaaagcttcagaactttttcacttaacagacagtgaaaactcaatc
ccatgtctgaagctggatactactacatgaggatagctaaccttgacgac
gatgtcagacttggcttccaccaaggaatccctcaggttctgggcctgcg
ccggaccctgcaaaagcaccatgagaaatctctattagagccagcgcacg
gac
BLAST
BLAST Search