Query (optional)   in Class  

GrainGenes Sequence Report: MWG77-3

[ Printable Version ]  [ Submit comment/correction ]

Sequence
MWG77-3
Data Source
Kuenzel, Gottfried98.05.05
Probe
MWG77
DNA Homology
AA773673127noncereal_EST
[ Show all 24 ]
DNA
ttcttctagggtgaaggtgaaaatgaaattttcctctactcctaccttct
ctctttttgctaagcatgtattaaagtatcttgtttctttgaatctattg
tcc
BLAST
BLAST Search