Query (optional)   in Class  

GrainGenes Sequence Report: MWG812-5

[ Printable Version ]  [ Submit comment/correction ]

Sequence
MWG812-5
Data Source
Kuenzel, Gottfried98.05.05
Probe
MWG812
DNA Homology
C27888789rice_EST
[ Show all 426 ]
DNA
ggggtttcgtgcacaagaacggcgcaccaaataaatatttcagatttatt
acgactgcgtagcagcaaggcagcaaacccagttcacacggtgtcgctgt
cgcccattactgctccgtcgtcgtccacagcgacgccaacgctgcaccca
gccagaccccgcgagatccagagcctagcactagctggccggggaggagg
aaggtccaggacccgcgagacaggcaaggggatggcgggcagcggaggcg
gcgcctacagggcggaggacgactacgactacctcttcaaggcggtgatc
atcggcgactccggcgtcggcaagtccaacctgctctcgcgcttcaccaa
gaacgagttctgcctcgaatccaagtccaccatcggggtcgagttcgcca
cccgcagcctccaggtcgacggcaaggtcgtcaaggccagatttgggaca
ccgctggccaggagaggtgcttgctcgcctcccatctcttaattactaac
tcctgccacttcctgttagtagctgttcaatcgctggtagtagtatgctc
gccagtatggatttgcttgcttcctgatctgtttcttcggacccaggatg
ctaccttcgcttggccattcatttgctctatcaaattagtttggtgatgc
tggtaatctggtgattgcctcatttttgttgccagtctagacgatcttgg
tatagtgtggatcggagtggagtagtaaagcagtggcaaataccaaatga
agtactattgcttggtaccccaactcaggtctgcgtttcacttgattcgt
cctctaggttagatcggacacctacttgtgatttagctgttggactttcg
tttcttacatcttagagtttagtggtttggggttgaaaccattgttgttg
ttctagacttctagtggctgtggtgtcttcttttattggagttcatacat
aaaccagtggagagatgcatcgtggaattgttggattatgcaccagcaca
cttggtgtgaccatgcgaggggtgtgattggagaaggaaaggtgtgtcac
aggttttggaagatctgttggtgtggccttggcgatgaaatgacca
BLAST
BLAST Search