Query (optional)   in Class  

GrainGenes Sequence Report: MWG813-3

[ Printable Version ]  [ Submit comment/correction ]

Sequence
MWG813-3
Data Source
Kuenzel, Gottfried98.05.05
Probe
MWG813
DNA Homology
AI096162292oat_EST
[ Show all 140 ]
DNA
cagatggcgatggcgtcctagacgtaggcgtgcttctccagcagcttgag
cacctcctcctggctgttgagcctcgccacgtcgatggccgtcttcccgt
ccaggtt
BLAST
BLAST Search