Query (optional)   in Class  

GrainGenes Sequence Report: MWG851-5

[ Printable Version ]  [ Submit comment/correction ]

Sequence
MWG851-5
Data Source
Kuenzel, Gottfried98.05.05
Probe
MWG851
DNA Homology
AI069309269noncereal_EST
[ Show all 4216 ]
DNA
ccttgctggagaagctgagcagggacgccgaccaggcagaggacttgctc
gatgaggttcactacttccagatccatgacaagctacacggcaccaacta
cgccaccacccaagaggccggccatgatctggacagccttgtccgccatc
aagctctccacgctggtagcgctcttcgccacaccctaagcagcttggta
cagtgcttttcttgctcccctacacccaagaggaatggtggtgatgaata
tgatgctgctgttgttgccggtgcaccacgccgcgtcacgaataccctag
gcaccttgctccactgcttttcttgctcttgtacacccaagagcaagagg
aatggtggtgatgatgctgctcctgctgctgctgttgcctgcgtccgtgg
tgatgcttctgctgttgctgctgttgccggcgttggtggtgatgcttcta
ctgctgcttgtgttgccggcgtcaccaactccaactctgctagtcctgat
gatggtgatgcgccgcatttcgaccgagtgtccatgtccagagaaatcaa
gtccgtgttacagggcatgcagtcccactgtgattccgtctccaatttgc
tcagcactatc
BLAST
BLAST Search