Query (optional)   in Class  

GrainGenes Sequence Report: MWG872-5

[ Printable Version ]  [ Submit comment/correction ]

Sequence
MWG872-5
Data Source
Kuenzel, Gottfried98.05.05
Probe
MWG872
DNA Homology
AA450142151noncereal_EST
[ Show all 155 ]
DNA
aactgcgtggagttcgccgtcgccttcttcggcgcgtccttcctcggcgc
catcagcacggcggccaacccgttctgcaccccgcaggagatccacaagc
agttcgtcgcctccggcgccaaggtgatcgtcacccagtccgcctacgtc
gacaagctccggcacgagagcttcccgaggatcgccacgggcggcggcga
ggacacgctcgcggtgatcaccgtcgacgacgaggcgggtaccccggacc
ggctgcctgcccttcttggggat
BLAST
BLAST Search