Query (optional)   in Class  

GrainGenes Sequence Report: MWG913-5

[ Submit comment/correction ]

Sequence
MWG913-5
Data Source
Kuenzel, Gottfried98.05.05
Probe
MWG913
DNA Homology
AA231738884oat_EST
[ Show all 46 ]
DNA
ctggaggtgagcagagcacccttgaagcagacatcgttcttgtctctgct
gggagaaccccttataccgccgggctcgggctggatsccattggggttga
gatggacaaggctggcaggatcctcgtcgataagagattcatgaccaatg
tgaatggagtgtatgcgattggtgatgccatccctgggcccatgcttgcc
cacaaggctgaagaggatggtgtggcatgtgttgagttcctcgctggcaa
ggaaggtcacgtcgactacgatttggtgcctggtgtggtctacacacacc
cagaggtggsatccgttggcaagacggaggagcaggtgaaggcctcagga
attccctaccgvgttggcaaattcccgctcatggcgaacagccgtgccaa
ggctatcgatgatgccgaggggatggttaaggtcgtggctgacaaggaaa
ctgacaagattcttggtgtgcacataatggcgcagaatgctggagagatc
atccatgaagctgtgcttgcc
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.