Query (optional)   in Class  

GrainGenes Sequence Report: MWG914-5

[ Printable Version ]  [ Submit comment/correction ]

Sequence
MWG914-5
Data Source
Kuenzel, Gottfried98.05.05
Probe
MWG914
DNA Homology
[ Hide all but 1 of 14 ]
AI062334124noncereal_EST
AA202739120noncereal_EST
ATT19K4475noncereal_BlastN
BAC180K151noncereal_BlastN
BAC180K84noncereal_BlastN
HS256G22139noncereal_BlastN
BSUB0001151noncereal_BlastN
BSUB000184noncereal_BlastN
U66060124noncereal_BlastN
ATH224982124noncereal_BlastN
CEK09C8122noncereal_BlastN
HTU53066122noncereal_BlastN
HTU53064122noncereal_BlastN
HTU53060122noncereal_BlastN
DNA
aaatagagcgcacaaacgtcgtgaaaggtcagagacctataatatttgtg
ttgtgaaactgtgaaaatgaaaacagacatacttgtgtttgtaaatgttc
agcggagtttccagctggtcggcgcttcccgtgtccccgaagttgattct
gccatgaccgtcttccccgaagcacatggagaaggaatttgcggcgactc
cttggctcgccagcagactcggcaccgacttgctgtccatgccgagccca
agcaagccgttcggggcggcgctgcctagaaacgaacctgtctggacctg
tccacagctaacaatgcacacaaattcaaattcaacttcagaacagaaaa
gtaaacagtgactcaggattgcgcattgtcatgtatagaccacaagggac
atacccgaatgttatggggggcctgggtgatcttagagtgcccggactcg
gttdnbaggtacatgacatcctcgaccagcannccttttgacgacgtgtt
gtccgacaggtactcgatcttgtaggggcagctgtddntygcaghactgc
attcggtctgtagatcacacatattg
BLAST
BLAST Search