Query (optional)   in Class  

GrainGenes Sequence Report: MWG920-5

[ Printable Version ]  [ Submit comment/correction ]

Sequence
MWG920-5
Data Source
Kuenzel, Gottfried98.05.05
Probe
MWG920
DNA Homology
AA354016135noncereal_EST
[ Show all 114 ]
DNA
cgcgccgaggcacaccgagcacgtcgccgccgcctcctccccgtcaccgc
ccgtcacgttgcgcttcacggacgggctgtacgtgaacgccgggaggccg
gccgtggggctggcggcgcaggcccggccaagctgctgctcgccgacgac
gcgcacgccattgcgttcctgcacgggccamcgccaagcggcggccgcgg
ctcgagcgcgacggtcgcggtactcc
BLAST
BLAST Search