Query (optional)   in Class  

GrainGenes Sequence Report: MWG975-3

[ Submit comment/correction ]

Sequence
MWG975-3
Data Source
Kuenzel, Gottfried98.05.05
Probe
MWG975
DNA Homology
AB017065172noncereal_BlastN
[ Show all 13 ]
DNA
atggggacaaagcgacgttcgaggccatgtacctgggcacctgcaaaacc
ctgacgccgctgatgagcagcaaattcccggagcttggcatgaacccctc
gcactgcaacgagatgccctggatcaagtccatccccttcatccaccttg
gcaagcaggccaccctggccgacctcctcaaccggaacaacaccttcaaa
cccttcgccgaatacaagtcggactacgtctaccagcccgtccccaagcc
cgtgtgggagcagctcttcggctggctcacgaaacccggcgcggggatca
tggtcatggacccatacggcgccaccatcagcgccacccccgaagcggcg
acgccgttccctcaccgcaagggcgtcctcttcaacatccagtacgtcaa
ctactggttcgccgaggcagccggcgccgcgccg
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.