Query (optional)   in Class  

GrainGenes Sequence Report: MWG988-5

[ Printable Version ]  [ Submit comment/correction ]

Sequence
MWG988-5
Data Source
Kuenzel, Gottfried98.05.05
Probe
MWG988
DNA Homology
AA277318126noncereal_EST
[ Show all 14 ]
DNA
ccaagcttcttcgacggtgctgctccatgacggcggcgggacggcgccat
tgctggggatgggagagcatcatcatgtggcgtatgtccctcctcctcct
gttcatcgtcttcaagggccgtcctccgttctccacgcctacaacaaggt
cagtcctgccactgtataccgtcctcctgggtctaatgaaagagatggga
gaattaactgagagctatgatgaaaaatgtacaattaacgaggtagagaa
ctgtagggtagtaggagactgaattgtgaatttgctggcacaacagttgt
ataagtacatagtaggaatcaatacgtactaagtaggccgggatctaaag
tacttactaggcggttgaaagggaaaaa
BLAST
BLAST Search