Query (optional)   in Class  

GrainGenes Sequence Report: NSFT03P2_Contig13509

[ Printable Version ]  [ Submit comment/correction ]

Sequence
NSFT03P2_Contig13509
Contigset
NSFT03P2 EST
Contig Members
BG607512
BQ168610
BE591879
BU100661
Data at wEST
Contig annotation
Data Source
Chao, Shiaoman2003.01
Probe
BG607512-5A
DNA
gctcgcgcatagttggactggaaacctcatcaccaacaaaaccaacgagg
acttctggctaaatgagggtttcacaacatatgctgagaggaggattgtc
gaggtggttcaaggtgaggagcgggcggccttaaacagcggaattggatg
gagagggttgaacagaatgatggagaggtttaaggataacatggagttta
ccaaactgaagccgaagatggctgggattgatcctgatgatgtttactca
gaagtgccctatgagaaaggcttccagttcctttggcgcatcgaacgcca
gattggccgacctgcattcgatgaattcctcaagaagtatattgccaact
tcaagttccaatcgatagatacagagacatttcttgaattcctgagagcc
aatgtacctgggattgaaaatcaagttgaccttcatgagtggatcaacgg
tactggtctccctccggatgccatggagccagaatcagctacctataaga
agatttgtgtcttagctgcagagtttaagtctggaaaaattccaagtgaa
gaggaggtggcagactggagtggacaagaatgggagctttacttggaaaa
tttacccacagatgttgaagcatcacaggttactgctcttgatgaacggt
acaagctgtcagaaagtcgcgactatgaggtcaaagtcgcattcctccag
ctagcgatccccacgggctgcaggtgttacttcaatgaggtggagaaatg
cttgaagcaggtgggaaggatgaagtacctgcgcccgctctacagctcgc
tggcacggtgctcaggggaggaggagaagatgctggccaagaggatcttc
tcggaggcccaagagttctaccacccgatagcccgcggcgtcgcagagag
catccttttgaagcatggctagttgagttgaagccacattttaccgagtc
tgaagtagagagaacgtctgtgatgcctattgactgtttgctcgctcatt
tcttccgcataaaattatctctagagctgaccttggatgaaacactgaac
ttccttccgtgatgtgttatgtgagactgcatgtgcgtaatttattctga
ccctgtaaggaacttgaaactctgcctcctgataacaatatcctgtgttg
atactgctatgatctcttaa
BLAST
BLAST Search