Query (optional)   in Class  

GrainGenes Sequence Report: NSFT03P2_Contig13614

[ Printable Version ]  [ Submit comment/correction ]

Sequence
NSFT03P2_Contig13614
Contigset
NSFT03P2 EST
Contig Members
BF474781
CD453773
BE498570
BQ789566
BE587512
Data at wEST
Contig annotation
Data Source
Chao, Shiaoman2003.01
Probe
BF474781-2A
DNA
tcggcacgagggagctagctacgagcagcgcacgcccgggaaatcttgac
tagcactagctaaagctcaatagagcgctgtgccaagaagcagctaaaga
tgtgcagccatggccacgcggagccggcgatggcgtgcgtgacgtgcccg
ccgccgtcgcaggggcggctcatcacggtgctgagcatcgacggcggcgg
catccgcggtcttatcccctccaccatcctcgcctgcctcgagtccaagc
tccaggagctggacgggccggacgcgcgcgtcgcggactacttcgacgtg
atcgccgggacgagcacaggcgcgctggttacctcgatgctggcggcgcc
cggagagaacaagcggccgctcttcgaggccaaggaaatcaacaacttct
accttgagaacgggcccaagatcttcccgcagaagagctggggatttctg
accccgatggcgaatatgtttggcgcggtgatgggtcccaagtacgacgg
taagttcctgcacgacaagatcaagaacctcaccaacgacgtcaccgtcg
ccgacaccgtcaccaacatcatcgtcccgacgttcgacgtcaagtacctg
cagccgatcatcttcaacacgtacgaggccaaggtggacccgctcaagaa
cgcgcacctctccgacatctgcatcagcacatcggccgcgcccacctact
tccccgcgcactacttcaccaccggcgaccccgcgggcaagctgccggac
cgcgagtaccacctgatcgacggcggcgtggccgccaacaaccccaccat
ggccgccatgtccatgatcaccaaggaggtgttgcgccgcaaccccgact
tcacgcacggcaagcccgccgagtacggcaactacctcatcatctccatc
ggcacggggtccgccaagatggcggagaagtacaccgcgcccgactgcgc
caagtggggcgtccttcgatggctctatgacggcggcttcaccccgctca
tcgacatcttctcccatgcgagcgccgacatggtcgacatccacgccgcc
gtgctgtttcaggccctccgcattgagaagaactacctacgcatccagga
cgactcgctcacggggcacacatcctcggtcgatatcgccaccaaagaga
acatggaggcgcttatcgggatcggtaagaatctgctcaagaagaatgtg
tcccgggtgaacattgacacagggatgtatgaatccgtcgaaggtgaggg
caccaacgaagaggccctcacgcgcttcgccaggaagctctctgaggagc
gcaagctgcgccaaaccaacctcaactccaaatagagaagaggacgattt
gagcgaaagagaagagagacgaagaagcactagctagctgctatgcttaa
ggatgcaaacggccgataatctttgttattttaataaccgtgcatgtttt
aattatgctttcatggacaaacgtcgacgctgtccatttgcatccctagc
tatgctatagctaggtcgagagttgtaatataatgtaatgtgggtgggta
attattatttttaaataaaatctgagttgtgttcgctaccaccctctaga
tacaaaaaaaaaaaaaaaaaa
BLAST
BLAST Search