Query (optional)   in Class  

GrainGenes Sequence Report: NSFT03P2_Contig13936

[ Printable Version ]  [ Submit comment/correction ]

Sequence
NSFT03P2_Contig13936
Contigset
NSFT03P2 EST
Contig Members
BG263563
CD454760
BF484836
BQ482891
BQ752817
Data at wEST
Contig annotation
Data Source
Chao, Shiaoman2003.01
Probe
BG263563-4B
DNA
gccaacaataactgctggtgtaagcataaatttcagagatgttcatgggt
ggactgcacttcactgggcagcattttgtggcagagagcgaacagttgtt
gctcttatagcattaggtgcggctcctggagctttgacggatccaaggcc
tgatttcccttcaggacgcacaccagctgatcttgcgtcgttcaatgggc
acaagggaatttctggtttcctggcagagttttctttaacaagccatctt
caaaccctcaacctgaaggaagccatggggagcaatgcatcagaggtatc
tggtctacctggtattggagatgttaccggaagaattgcttcaccatcgg
caggtcaaggtcttcaggctggatcgatgggagattcactaggtgctgtg
cggaatgctgcccaagctgctgctcggatatatcaagttttcagggtgca
gtccttccagagaaagcaagcagttcagtatgaggatgacaatggtgtga
tatcagatgaacgtgccatgtcactcttgtcttataaaccatctaaacca
gggcaattcgatcccatgcatgctgctgcaactcgaatacaaaataaatt
ctgtggatggaagggaagaaaagaatttctgcttattagacagcgaattg
tcaagatccaggctcatgtgcgaggtcaccaagtgagaaagcattatcgc
aaaataatttggtctatcgggatagtggagaatgttatattgcgatggag
gcggcgaggagctgggttacgcgggtttcggtctacagaaggtgcaacag
acagcagcactagtagcagcagtgtcgatgtaatcccagttaaacctgca
gaggatgattataacttcttgcaagacggacggaagcaagctgaagaaag
actgcagagagctcttgccagagtgaagtccatggttcggtaccccgaag
cccgggaccaagatcagaggattctgactgtcgtaacaaaaatgcaggaa
tcccagcttgtggaggaaactttgcttgaggagtcgacggagatggatga
aggcttttttgatgagtgaattcaaagagctctgttatattatgcagcaa
attcaagtataaagagaaagggtaacttccgacgagcgagcggggccgaa
gcggaatgaaataccttgagatgtgatctgtgcagaaataataaattcat
ggacttttgggatgaatagtatcatgtgttggaaagccacatatttgtct
tttttgcacagccctcgtttcaacttatttcgtcctgaaaatttacacac
atgtgtgttatgcctccatgcatgtctattttttttagaatttttgaaat
gtaaaattatgatttttgttgaattttgaatttttcaaaaaccagcctcc
atggaggctgattttttttgaaaaatcatatatcaaaattcatacttttt
ggtttaaaaaaaaaaaaaaaaa
BLAST
BLAST Search