Query (optional)   in Class  

GrainGenes Sequence Report: NSFT03P2_Contig14322

[ Printable Version ]  [ Submit comment/correction ]

Sequence
NSFT03P2_Contig14322
Contigset
NSFT03P2 EST
Contig Members
BE591013
BQ171686
CD492025
BQ801583
BG274409
Data at wEST
Contig annotation
Data Source
Chao, Shiaoman2003.01
Probe
BE591013-3B
BE591013-3D
BE591013-3A
DNA
gggaagaagcctttgacagatcaaacttccgtaactgccttctcaacgat
gtttgccaggagatgtcaggatatgatattgctagagaatattttgtatc
taagcacatcgatccctcctgtgatccaaaagatatggtacggagattaa
cacatccttatcttcggaggtgtgcattgctttgggagctgctaaaatcc
tcttcctcagcacccttatatgacagttccaatatttgggaagggtcaca
tcttcacttagatagtagcacagcggaaggcaattcttcactgtcaattg
agctggatggaatacgagaactggaacacctctttcaaattcagccactg
gacctgattctcaaagatgagtgtgtacatatgcttgccttaagatggtc
tcaacatttctgtgaagactacagatctcgcaagtatagaggcatcctct
tttctacccccgcggtcccattcaggctgatgcagttaccacctgtctac
caagttctcctagaaagatatgtcaagatgcaatgccctgattgtggttc
agtgcctgatgagccagcgttatgtttgctttgtggcaagctatgttcac
ctagttggaaaccatgctgcagggctggtaaatgcctaaatcatgcgtct
cagtgtggtgctggtgttggcatatttcttttggtgaggaaaacaacaat
cctgttgcaacgatcggctcgtcttgcattttggccatctctgtaccttg
atgctttcggtgaggaggatcatgaaatgcacagaggaaagcccttgtat
cttagccaagaaagatacgcagccctcacatatctggtggcatctcatag
ccttgaccggacttctgaagttctgcggcaaacaaccatcagcttttata
catctgattaagtgcatcgttttgaggaacaatgcccaaaggatcatgtg
atgtgcatattttctgggaactgtcgtctagcttcatattcatgctttcc
agtgatggtgaattgcatccattcccaaggtggcgcggattctgccagac
tatcgagccgtgtgtcggtgtttcagaccttgttcgcgcacaatgtacag
cggtgcctatggtgccccttttttctttcctttttcgttctgttagcatg
tgaccggatggttggttgaactgttcacattgtacaaattcgccgtgcga
aactatctgcaagaaatgtaggctttaaaaaaaaaaaaaaaaaaa
BLAST
BLAST Search