Query (optional)   in Class  

GrainGenes Sequence Report: NSFT03P2_Contig15043

[ Printable Version ]  [ Submit comment/correction ]

Sequence
NSFT03P2_Contig15043
Contigset
NSFT03P2 EST
Contig Members
[ Hide all but 1 of 6 ]
BE636802
CD453246
BF199522
BF482941
BQ752655
BE446137
Data at wEST
Contig annotation
Data Source
Chao, Shiaoman2003.01
Probe
BE636802-2B
BE636802-2A
BE636802-2D
DNA
cgctctcgcggccgtcaccgagctgaatttcaacatgattggattcctgg
gggcgatgatctcgaacctggcgttcgtgttccggaacatattctccaag
aaggggatgaagggcaagtcggtgagcgggatgaactactatttctgttt
ctccatgctgtccctggtgatcctcctccctttcgccttcgccatggagg
gccccaaggtgtgggctgcaggctggcagaatgcagtcgccgagatcggt
cccaacttcgtctggtgggtggcggcgcagagcgtgttctaccacctgta
caaccaggtgtcgtacatgtcgctggacgagatctctccgctgacattca
gcgtgggcaacaccatgaagcgcatctcggtgatcgtcgcgtccatcatc
atcttccgcacgccggtgcagcccgtcaacgcgctcggggcggccatcgc
catcctcggaaccttcatctattcccaggcaaagcagtaagggaactcga
ccaaacttccgacgagagtcggcccggcgttcggacgttatatgttgttg
agcatatctaattaagaactccccttgtaatatatattaggaaccttctt
cttcttcttcttttcagtttttttctaggtttagctgctcggatgtctct
aaatacttggtttgttgttccgtgaccatggtgctggtgatgtagagagg
tgaatgaatccgtccaaataaagttgccaggaattttgcccccaaaaaaa
aaaaaaaaaaaaaaaaaaaaaa
BLAST
BLAST Search