Query (optional)   in Class  

GrainGenes Sequence Report: NSFT03P2_Contig15173

[ Printable Version ]  [ Submit comment/correction ]

Sequence
NSFT03P2_Contig15173
Contigset
NSFT03P2 EST
Contig Members
BE490130
BQ161210
BM136276
BM138378
BQ752634
Data at wEST
Contig annotation
Data Source
Chao, Shiaoman2003.01
Probe
BE490130-6B
BE490130-6D
DNA
ttaatggcgatactgatggagcacgtgcagaatatcaacatctccactca
gtgttatatcctggcctcctcgaagccattgtgaagcatgctaatatgga
gcaccggctgggagataaggaatctgcttgtttagtctatgagaaggcca
ttgctgctgaaaaggagaaggagcagagccagcttttaccaatgctactg
attcagtactcacgtttcttatatatggtcggtgacttggaaaaggcaag
ggagatctcaggtggactgcacgggctagctaaccttactaaaccagttc
ttgaggctgtcatctttcttgagtcgatcttccaatctgagaagcgtatt
gatttgttagaatcactggtggagaagtttcttacagctgaacagactca
aggggagctggcaagcttaagtgacaaagaagaattatcttccatatatt
tagagtttttggatacgtttggggatgtacagtcaatcaagaaggctaca
actcgacatactattctcttttcacgtaaaaggagcattctgccatcaaa
gaaacgaagagcagatgatgctgtcatgtccggtagagataaaatggcta
aaaccggagatggcacccaaccaggcatgggaactgatccaaatgctcat
aatcctgcagtttggcctgcgacttctgaagcatcagcgcagcaatgggg
ggctgcttacgcacagcaggctgcttatcctgcatatggagcttacgact
acagccaacaaatgccccaatctgctcctcaagcagccgcttatggtgcc
tatcctcccacataccctgcccaggcctacccgcagcagagctacgcaca
acctgcagcgatgcccgtggcagcagcagtgcccaccccagcacaggcgc
cggcacccgcagcagcttaccctcagcaacctgccgtggctgccgccccc
caagcttactacggcggcgccgccacgtactactgattgcttgattggtg
cgcacactaaggggcgggtgttctcaatgcatgggcatgtgtacctacgt
agctgccttacatagctgtgaccccccttgggtatcgtgtatgcattggc
aggaagtttttttggcagcagcaggccaaagaagaagaaaggcaagaccc
tttttgtttgtcgaggtgtaactagttattcagtcagatgcttattgcag
cagcagcagcagcacttgtaatgcgtccagatcttggatcaaaaaa
BLAST
BLAST Search