Query (optional)   in Class  

GrainGenes Sequence Report: NSFT03P2_Contig15977

[ Printable Version ]  [ Submit comment/correction ]

Sequence
NSFT03P2_Contig15977
Contigset
NSFT03P2 EST
Contig Members
BQ172137
[ Show all 6 ]
Data at wEST
Contig annotation
Data Source
Chao, Shiaoman2003.01
Probe
BG606097-1B
DNA
gctggtgctaaagtgacgaggccaagcacattccgcagttgtcaagatgg
atatgccgtgaaatcatcacttaaagctgaagatggattgctgtatcctc
ttgaaaaaggctttttctttttgccaaagcccccgacactcattctgcat
gaggagattgagtatgttgaatttgagcgccatggtgctggtggtgctag
tatgtcatctcactattttgatcttctggtcaagctaaagaatgatcaag
aacatctcttcagaaatatacaaaggaatgaataccataacctcttcaac
ttcgtcagtggtaagaatttgaaaatcctgaatcttggagaagatggcca
agatagaactggtgctgttgcggctgctcttcagagcactgatgatgacc
ccgttgatccacatctggagcgaattaaaaatcaggccggtgatgaagaa
agtgatgaagaggacgaagattttgtggctgacaaggatgacagcggatc
ccctagtgatgattctgaagagggttctgatgccagcataagcgatggag
aaaaggagaaatcttccaaaaaggaagctagtagctcaaagccacctgtg
aagaggaaaccaaagaatgtggacgtggaaggttcagagaagagaaagcc
gaagaagaagcagaagaaagatcccaatgcccctaaaagagcaatagcac
cattcatgtatttctcaaaggctgagcgagctaatttgaagaacatcaac
cctgaactcagcaccactgatattgcaaagaagcttggagagaagtggca
aaagatgtcagctgaggagaagcagccatacgttgagcagtcccaagtgg
ataagaaacgctatgcagaggagtctgctgcctaccgcggcgctggtgcg
gctcctgtagacgtggactctgcagatggatcgtccgattgaattggaag
attggccgatgtcgaaaggagcatactttcgagtcatggtacaagtaggc
atccgatctatcttgctgtagtgactgttgaggtgtgatccctacgtttc
tgagttaacaaacaacagttaggatatgtaggttccacaggtgatgttta
ctttgctaagagctgtcagcacatgtgacaggtgttttattcgcaccctg
cttgtgcaaccttttttctgcaaaatactcaaatcttcaccggaattaca
aagcatacaaaacatactccctctgttcacttttatgtcgacgcggccg
BLAST
BLAST Search