Query (optional)   in Class  

GrainGenes Sequence Report: NSFT03P2_Contig16187

[ Printable Version ]  [ Submit comment/correction ]

Sequence
NSFT03P2_Contig16187
Contigset
NSFT03P2 EST
Contig Members
BE591127
[ Show all 7 ]
Data at wEST
Contig annotation
Data Source
Chao, Shiaoman2003.01
Probe
BE591127-7D
BE591127-7A
DNA
aggagggcggggcgacggtgttccggggcaccaactactcgctgccgcgg
acgatcgcggcgctggcgctgtggctcgggggcatccacttcaacgtcct
cctcatcctcgcctcgctcttccacttcccgctccgcctcgccgccctgg
tggtggcgctgcagctcatcttcatggtcatccccctcaacgacgaggac
aaattgggccgcaaaatcggcaggttcatatgcaagtacgccatgggcta
cttcccgattagcttgcatgtggaggactacgacgccttcgattccagca
gggcttatgtgtttggctatgaaccgcattctgtgctgccaatcggcgtg
gcggctctggctaatcatgtcgggtttatgcctctgccaaagctcaaagt
ccttgcgagcagtgcggtgttccacaccccattcctgaggcagatatgga
catggataggactgattgctgcaacgaggaagaatttctactcctacctt
gcagctggttacagttgcgttgtagtgcctggaggtatacaggagattct
tcatatggatcatgattccgaggttgctttccttaattcaagaaaagggt
ttgtcaagatagctatgcaggctggctgccctttagtccctgttttctgc
ttcggacagagcaaagcttacaggtggtggaggccaggaggcaaattgtt
tgtgaacattgctagagcactgaaattcactcctattatcttctggggaa
gatacgggacaccgatcgctttctcggcacctatgcatgtggttgttggt
agacccattgagctgaagaaaaatcctctgcctaccattgatgagataaa
cgaagtgcacggacaattcgtcggcgccttgcaagaactgtttgagaagt
acaagacgaaagccggatatcctggcctccatctgagagtcctgtaatac
tttcttgtggagaacaagtttcttgtaacatcacggcaattcaccgacgc
ttgcggcctgttcgatcattgcacgatcgttagcatgatgctcgggttcc
ttgagttgttatactgccatg
BLAST
BLAST Search