Query (optional)   in Class  

GrainGenes Sequence Report: NSFT03P2_Contig16343

[ Printable Version ]  [ Submit comment/correction ]

Sequence
NSFT03P2_Contig16343
Contigset
NSFT03P2 EST
Contig Members
BE425081
[ Show all 8 ]
Data at wEST
Contig annotation
Data Source
Chao, Shiaoman2003.01
Probe
BE404580-2B
DNA
gcgggggccgcacccagttgccttgttgctttctccttctccaagtaaac
tcagtttccacagctccgccgcgccgccgattcgccagccatgccgacgg
tatgcataaaatggcagaagcaggtatttccaggcatagagattgatact
agccagccgcctatggttttcaagacccagttgtacacactgactggtgt
accccctgaacggcaaaaaaattatggtgaagggtggaatattgaaggat
gagacagattggtctactttgggacttaaagatggtcaaaagttgatgat
gataggtacggctgatgaaattgtgaaagctccagagaaaggccctgtgt
ttgttgaagatttaccagaagaagagcaagcggctgcattggggcatact
gctggtctctataacttggggaatacatgttacatgaattccactcttca
gtgtctgcattctgttccagagcttaagtcagcattactgagttattcag
ataacgtgaggggcaatggggtggatcaagcatcccatagtttaacagtt
gcaactcgtaatactttcggagagcttgatcaaagcgttcgaccagttgc
acctctgcacttcttacagatgctgcggaaaaaatacccccaatttgctc
aacagcaaaataatgtttacatgcagcaggacgcagaggagtgctggaca
cagctgatctatacgctttctcaaacacttacatcagaagcaagtgaacc
tactgctgctcagatgaaggaacttttcgggattgatcttgtgagcaggg
tacactgtgcagaaagtggtgaggagagttcagagtcagagtcagtttat
tctctgaagtgccatatatctcatgatgtaaaccaccttcatgaaggact
gaagcatggtttgaagacagaacttgagaaggtttccccatcactgggcc
ggactgctatttacacaagagagtcgagaataatgagttgcctaggtact
tgactgtgcagtttgttcgtttcttttggaaagggagtcaaccaaaggcg
aagatttacgtaagtggattacccttgagcttgtgtctt
BLAST
BLAST Search