Query (optional)   in Class  

GrainGenes Sequence Report: NSFT03P2_Contig16795

[ Printable Version ]  [ Submit comment/correction ]

Sequence
NSFT03P2_Contig16795
Contigset
NSFT03P2 EST
Contig Members
BF483498
[ Show all 6 ]
Data at wEST
Contig annotation
Data Source
Chao, Shiaoman2003.01
Probe
BF483498-3D
BF483498-3A
DNA
tcctccttccccaccccacccccgtccaaaccacccccacccctcctccg
ccactcctcctgcctgccgattgtcgggattaatcgggggcttccgcagc
agccagcgggtagtcggcggcggcggcggcggttttctgattcgcttgcg
aggcgctgccgtctgaccctcttcccggcggcgatgggccagggcgtcgt
cgagatccagccccgcgagctccagttcacctttgagctgaagaagcaga
gttcatgttctgtccatcttgtcaacaaatctgatgaatatgtcgctttc
aaggttaagactacttcccctaaaagatattgtgtccgaccaaatatcgg
agttatccttccaagtgcaacatgtgatttcacagttaccatgcaagcac
agcgtactgcgccaccagacatgcaattaaaagacaaatttttggtgcag
accacagttgttcctcctggtacatcagatgatgacctcattcctgcttt
tttctccaaagaaaccaacgcatatattgaggaaagtaaattgagagttg
tccttgttgatgcatctcgtcctcctgtggagcaactgataaataatgtc
cccagcactgatgcggcagttgaggttccggtgttaaaagatacaccaaa
tgttcagaatgaagtgccagctatggagaaaaaggttcctgccccccagg
agaaaatttcagctgttgttcctaacataccttcccctgtcagggagtct
ccaatccttcaagaagttcctgtgctactgcatgaagaacctgctatttt
ggcagaatctcctccccctctaaaagacgaatctcctccccctctaaaac
atgaatctccttcctatataaaggatacgtctgcggttaccatcgaacag
ctttctcctctgaaggaagagactgtaacttcaaaggtgtctcctctgga
agaaactcttccgaaagaaactgtcaccgtaagtgaccgaggttttttca
gtgtgcagaatcatcaattatctcatgtgacggaagatgttcagaatctg
aagtcaaaactccacaaccttgaatcaaaattggaaggggctgaaaagat
gataataacactgagagaagagagctggactacaacccaggagcgggata
ggctgcagcaagagatggtatttttagagaagggaaccccaaagagtcag
ctaggcttcccgttgctgtttgaggtctatgtggcgcttctcggcacatc
cctcggctacctcttgcgcctatgagttggagtatgttggagatccaagc
cgccgggtgcttcagtcttcgtcaagagttgaagggcagctatatacata
aatgttgcaggagcatccctgttagcagcaccatcgtttgttattaatta
gttgagacggttttgaacataccagggttattgccggtagcctgcctgta
tagaacagcgtttacattatatagaaccgcctgaaaaaaaaaaaaaaaaa
aaaaaaaa
BLAST
BLAST Search