Query (optional)   in Class  

GrainGenes Sequence Report: NSFT03P2_Contig17189

[ Printable Version ]  [ Submit comment/correction ]

Sequence
NSFT03P2_Contig17189
Contigset
NSFT03P2 EST
Contig Members
BE403421
[ Show all 9 ]
Data at wEST
Contig annotation
Data Source
Chao, Shiaoman2003.01
Probe
BE403421-6A
BE403421-6D
BE403421-6B
DNA
ggcacgaggagagagagaactccccacaagaccatcaaattccccacccg
caaccctttgctcgactcaaaaccctcgacaagcgctgtcgacctcgcgc
ggccgccgcaacaatggcgtcccttttcaaggacccgagcaagctgtcgg
tgtacagggaccggcggttccctgggacgcaggaggagtttgaggcggcg
ctgctggcgtcgctgacggtgtacgtggggaacatgtccttctacaccac
ggaggagcaggcctacgagctgttctcccgcgccggcgagataaaaaaga
tcatcatgggcctcgacaagaacaccaagaccccctgcggcttctgcttc
gtactgtactactccagggaagatgctgaagatgcagtaaaatatattag
tggcacaatgcttgatgatcgcccaatccgtgttgattttgattggggct
ttgaagaaggcagacaatggggccgtggaaggagtggtggacaagtccga
gatgagtaccgcacggattatgatcctggaagaggtggctatggcaagat
ggttcagaaagagctagaagcacaaagagaattagttgactatggtgtag
gttttcaaacgaatgctccaccgcagtttgatagagctgacaggaagaga
ggatatggcgaccggaatgacagaggagattaccaacggagacggtcggc
accagatatggccaggagagcaactgactcggattctaagagagatgcta
atcaagagcctgaaaagaatcccaggtttcgcgagaaaggtgattctgat
gatgaagatgacgactacgataagaaacgctggcgctgaacccgagaagc
aaattgctgccatattcaaatgcacaatagtagtattatctatccgtttg
tatgccatatgacttgattttcccttgagccattcacattttgcctccat
tttagaatcagttcatcaacatagtgcagcctttgcatgacttgcacccc
ctgaaactcttgcatgtgtatgctgctgattaagactattaagttctaag
aatagtgaccattgggtgctggccactgcttaaaaaaaaaaaaaaaaaaa
a
BLAST
BLAST Search