Query (optional)   in Class  

GrainGenes Sequence Report: NSFT03P2_Contig17344

[ Printable Version ]  [ Submit comment/correction ]

Sequence
NSFT03P2_Contig17344
Contigset
NSFT03P2 EST
Contig Members
BE424468
[ Show all 11 ]
Data at wEST
Contig annotation
Data Source
Chao, Shiaoman2003.01
Probe
BE637570-6B
BE637570-6D
BE637570-6A
DNA
attactactacacctctcacatctgctctttggttccacagcttccttcg
acaccttcgtccagaaactctcgcggacatggcggccgggaagcgcacca
tcggcctcgcgatggactactcgccgtccagcaaggcggcgatgaggtgg
gtggtcgagaacctggtgaaggccggcgacaggatcatcctcatccacgt
cctacccaagggagcagacgccagccacaaggggctctggaagagcaccg
gttcacctctgatccccctgctggagttcatggagatgaacgtgcaggcg
cggtacggggtcaaccctgacaaggaggtgctggagatcctgcaggctga
gtccaagtccaagcaggtggaaatactggcaaaaatatactggggtgatg
caagggagaaactttgtgaggcagtagatgatctcaaggtcgactctgtt
gtgcttggttgcaggggattagggcccttaaaaagggcactccttggaag
cgtcagcaattatgtcgtcaacaatgcaacctgccccgtcacagtggtgc
gtggacccaatggatcacttgcttgaagatgtcgcttctagaatgatggc
ctagtttgcgtgttcattggtccgtcggcgtacgggcaaatggtgctatt
taagacaatagtgatattttgccttttcggaacctttgctatccttgtag
tgcaatctcagtgtgttctcctctgttatctcttggttatacaacatttc
tgttgtttcttacatactatttgaaaaaaaatgcctacagacttgttcag
tgggcattttcgtttaaaaaaaaaaaa
BLAST
BLAST Search