Query (optional)   in Class  

GrainGenes Sequence Report: NSFT03P2_Contig17388

[ Printable Version ]  [ Submit comment/correction ]

Sequence
NSFT03P2_Contig17388
Contigset
NSFT03P2 EST
Contig Members
[ Hide all but 1 of 11 ]
BE446683
BE492400
BE500049
BE517247
BQ281663
BQ838393
BQ838431
BQ839495
BU100075
CA500503
BQ840725
Data at wEST
Contig annotation
Data Source
Chao, Shiaoman2003.01
DNA
attcggcacgaggggggagcgcgagggacgaaggaggggcagggcgagac
cttcggggagactcccacccataccgcgccaccgagcgagcgagatcccg
ccctttccccttctccacccacccgccctgccggacccgatcccgatctg
atctcgccgccgccgccgcgcgccggacaagatggcccccgtgtcggctc
tggccaagtacaagctggtcttcctcggcgaccagtccgtcggcaagacc
agcatcatcacccgcttcatgtacgacaagttcgacaacacctaccaggc
tacgattggtattgatttcctgtcgaagacaatgtaccttgaagatagaa
ctgtgagactccaactctgggatacagctggtcaggaaagattcaggagt
ttaattccaagctacatcagagactcttcagttgctgttattgtattcga
tgttgcaagcaggcagtctttcttaaacacgtcgaagtggattgaggaag
ttcgcactgagaggggcagtgatgtcattattgtgcttgttgggaacaaa
actgaccttgtggacaagaggcaagtatccattgaggaaggggaaggcaa
ggcaaaggacctcggtgtgatgtttattgaaaccagtgctaaagctggtt
ttaacattaaggctctgttccgcaagattgctgctgcactgcctggaatg
gagaccctttcatcagcaaagcaggaagacatggttgatgtgaacttaaa
gtccagcaatgctaactcatctcagtcgcaggcacaggctgggggatgca
gttgttagctccagtccctaacactcgcagctcatgatgtcaaagatccc
atgcccatcaaacagcaaccctaccttactgcttccctctcggtctcagg
aggattgattgtctcacggcagttgagtccatgatccaagtcaatgaacg
agaaccattttcgttggaaagatacgtttttatgtgttcttagtattttg
tcagtggcctaagctagcaacagtgtatagttggggttggcactgtgaac
tcctatcg
BLAST
BLAST Search