Query (optional)   in Class  

GrainGenes Sequence Report: NSFT03P2_Contig17414

[ Printable Version ]  [ Submit comment/correction ]

Sequence
NSFT03P2_Contig17414
Contigset
NSFT03P2 EST
Contig Members
BE403710
[ Show all 12 ]
Data at wEST
Contig annotation
Data Source
Chao, Shiaoman2003.01
Probe
BE403710-5,4B
BE403710-5,4D
BE403710-5,4A
BE403710-5D
BE403710-5B
DNA
ttcggcacgaggattcccctcccgttccgtcctgcggcggctataaagcc
aggctctgctcctcctctgccgcggctttgactcctacggccggatggcg
cgcaccaccgtggccgtgccggactcgctggcggcaccatgattggccta
cccctgccacactgccttgtctactctgcccaccgcatcaccccactccc
ctcagtcactctcccccctctcctgagtcctgaccgagccgagcggagca
ggtgaggaagaggaggccttctcgccgatccatctccggcggttcacgcc
gccgccgcattcaaggcgcgggctttgaccggacccgagttaagaggggg
cgtcggtggaaggggaagaagatctgtcgccgccggcaagatgcggagat
ccgcgccggtatttcaagcccttttggttttcctaataacaataattgag
acccaatggtccagcgtatccggcatgtactgcgcggacatggcatcgac
cgtctaccgaccacatagtgtcactataactgagtttggtgctgtcgggg
atggcgtgactctcaacaccaaagcattccagaatgccatcttctacctc
aattcatttgcggacaagggtggcgcgcagctctttgtgcctgctggaag
gtggctgacaggcggttttagtctgatcagccatctcactttgtcgctgg
acaaagatgcagtaataatcggatctccgcactcatctgattggcctgtt
atagaccctcttccatcctatgggcgcgggagagagctccccggaggaag
gcaccagagcttaatttttggctcccatttgacagatgtaataattactg
gtgctaatgggacaattgatggtcaaggagccatttggtgggattggttc
cataacaacacactgaactatactaggccacatcttgtcgagttgatgta
ctccaccaatgttgttatatcaaatttgactttcaagaactccccgttct
ggaatatccatcctgtatactgcagccaagttattgtcgagcacgttaca
atcctagcacctttgaattcgccaaacaccgacggcattaatccagattc
gtccacaaatgtttgcatcagtcattgttatgtcagaaatggagacgatg
ttattgtcatcaaaagtggttgggatgagtacggcatttcttttgctcag
cctagctccaatatcagcatcagcaacatcacaggagagactgggggtgg
tgcaggaattgccatcggaagtgagatgtcaggtggcatatctgaagtcc
gggctgaaggcctccgcattgtgaactcattgcatggaatcagaatcaag
accgctccaggacgtggagggtatgtaaggaacgtctacatagctaatgt
gagcatgcacaatgtttcgatggccataaggatcaatggaaactacggcg
aacatcctgacaacaattatgacaggaacgctctccccattataagcaac
atcacaattgagaacgttgttggcgtcgatgttggtgttgctggcatctt
ggagggcatcgagggcgacaacttcagcagcatatgcatctccaatgtct
ccctcagcgtgcgatccaggcatccgtggaattgttcgcttatccagggc
tattcaaactctgtgactccagagtcgtgcgagcagctcagagcagattg
tgaagagacatcgatctgctacgacggtggcagttctttagccgttggtt
cacgggcatccatacataataagcctagtgccagcatattactaaattcg
ttattgcagttggtgtcgctgtaatgtaggtagatatatatgcttgttat
ttgttgcaaaggggctttgcgtcatgggatgcgtcgtgttagccatgtat
atcttatttttgcaatcagttttgcttagaatgcaatttgtttctttgta
aaaaaaaaaaaaaaaaaaaaaa
BLAST
BLAST Search