Query (optional)   in Class  

GrainGenes Sequence Report: NSFT03P2_Contig17509

[ Printable Version ]  [ Submit comment/correction ]

Sequence
NSFT03P2_Contig17509
Contigset
NSFT03P2 EST
Contig Members
BE444562
[ Show all 12 ]
Data at wEST
Contig annotation
Data Source
Chao, Shiaoman2003.01
Probe
BE444562-5D
BE444562-5A
BE444562-5B
DNA
attcggcacgaggctcccccgtgctctcccccaaatcgcctccccgcacg
ccaccgccccacgccaccgccggcgaggagggaggcgccgtcggaggccg
cggcaggcggacgggagggcgccggccgggcggttcaagatgggcgactc
gtactgccaggactgcaagaagcacacggaggtggccttcgaccactcgg
cgggggacacggtctgcaccgagtgcggcctcgtcctcgaggcgcactcc
gtcgacgagacctccgagtggcgcaccttcgccaacgagtccaacgacaa
cgaccccgtccgcgtcggcgggccctccaacccgctcctcaccgacggcg
gcctctccaccgtcatcgccaagcccaacggcgcccacggcgacttcctc
tcctcctccctcggccgctggcagaaccgcggctccaaccccgaccgctc
cctcatcctcgccttccgcaccatcgcaaacatggctgacaggttgggtc
ttgtggctactattaaggaccgagccaatgaaatctataagaaggtggaa
gatctcaagtctatcaggggaagaaatcaagatgctatattagctgcttg
tctgtatattgcttgtagacaagaagatcgtcctaggactgtaaaagaaa
tttgctcagttgccaatggagcaacaaagaaagagattggtcgagcaaaa
gagttcatagtgaaacagctggaagttgagatgggccaatctatggagat
gggaaccatccatgctggagatttcctgaggcgtttctgttcaactcttg
ggatgaacaatactgctgttaaagcagctcaggaggcagttcagcgctca
gaggagcttgatataaggaggagtcctatttcaattgcggctgctgtcat
ttatatgataacccagctttcagaggacaaaaagccgcttaaagatatct
ccttggccaccggagtggcagaaggcaccatcaggaattcatacaaggac
ctgtacccctacgccgcgaggctcatcccgaactcgtacgccaaggagga
agacctgaagaacctgtgcacaccataggagccgagtcgcagccatttct
tccttttctctcgctctttttcttgttacataacttttgaaaattagatt
tgtcggagaggagtttcgttgttgtgagttgcttcaccgggccatgtata
ccccccgcctaattttatgtgcatggacctgtcggattcgggacgaagct
aagttataagatgtggctt
BLAST
BLAST Search