Query (optional)   in Class  

GrainGenes Sequence Report: NSFT03P2_Contig17976

[ Printable Version ]  [ Submit comment/correction ]

Sequence
NSFT03P2_Contig17976
Contigset
NSFT03P2 EST
Contig Members
BE443008
[ Show all 15 ]
Data at wEST
Contig annotation
Data Source
Chao, Shiaoman2003.01
DNA
gattcggacgaggcgccacccgaccgcagccgtacgccgcagatccgccg
ccgcgctagggttttcgcgccgaggggagaggggagatggacgtggtgaa
ggcggcgcagctgtcggggcggacgctggagaaggtggtggtgcacccgc
tggtgctgctcagcatcgtcgaccactacaaccgcgtcgcccgcgacacc
aggaagcgcgtcgtcggcgtgctcctcggcacctcctcccgcggcgtcgt
cgacgtcaccaactcctacgccgtcccgtttgaggaggatgacaaggacc
cgaggatctggttcctcgaccataattaccatgagtctatgttctccatg
ttcaagaggatcaacgccaaggagcatgttgttggctggtacagcactgg
tccaaaactaaaggagaacgacttggatgttcatgcattgtttaccaact
atgttcctaatcctgtcctggtgattattgatgttcaacccaaggagttg
ggaatacccaccaaagcatattatgctgtagaagaggttaaagagaatgc
tactcagaaaagtcagaaggtgttcgtccacgtgccatcagaaattgcag
cccatgaagtcgaggaaattggagttgagcaccttctgagggatgtgaaa
gacacaacaataagcacacttgcaacagaggtcagcagcaagcttgcagc
cctgaaaggactcgatgcgaggcttacggagatccggggttatctagatc
ttgtaattgaagggaagctcccactgaaccatgagattctgtaccacttg
caggacgtgtttaatctgctccccaatctcaacgtaaatgagctcattaa
agcctttgcagtgaaaacaaatgatatgatgctggtcatatacctgtctt
ctcttatccggagtgtcattgctctccacaatttgatcaacaacaagatg
ctaaacaaggaacacgagaaggccgaggatttgaagccagccgccgtacc
tactgcagccgggagctgaatgtccttgtttgcctcaacatggggatagc
gatctatgacccagcatggggcaaaagaaactgtgacatgttagcattgt
ctcatttgtaccaagtgtcttgaccttcaatttacactttgatgtttact
tcatgtacgacgaggtcaacgacaaaaccttacattctgtgagctctagg
tctttttgaggtttataatctagatcttatactgtttcaaaa
BLAST
BLAST Search