Query (optional)   in Class  

GrainGenes Sequence Report: NSFT03P2_Contig18083

Sequence
NSFT03P2_Contig18083
Contigset
NSFT03P2 EST
Contig Members
BG274948
[ Show all 16 ]
Data at wEST
Contig annotation
Data Source
Chao, Shiaoman2003.01
Probe
BG274948-5,7D
BG274948-5D
DNA
caaatcctgctctgtatgtgctgagggagagataagaagggtcttcagtt
gtattcatctgaacccaccgagccatatctgtcttcgcagaactatggag
agatattcagcaatcaaatcatatggtttgtggatgacacgaatgtctat
cgagttaccattcacaaaaccttcgagggtaacctgaccaccaaacctat
caacggtgctatctttattttcaatccaagaactgggcaactatttctga
aggtcatccacacaagtgtatgggcaggacaaaagcgtctagggcagctg
gccaagtggaaaactgctgaggaggttgctgcgttagttcggtctcttcc
tgtagaagagcagccaaagcaaattattgtgacaaggaagggtatgttgg
atccattggaagtccatctgcttgatttccctaacattgttatcaagggc
agtgagttgcagctgccattccaagcttgcttgaagattgagaagtttgg
tgatcttattctcaaggctacggaaccgcagatggttctttataacatat
acgatgactggctgaaaagtatctcgtcctacaccgcattctctcgtctt
gtgcttatattacgagcattacatgtcaataatgagaaggccaagatgtt
gctgaagcctgacaagacaattgttacggaaccacatcatatctggccat
ctttgactgacgagcagtggctgaaggtcgaatgtgcactcagggatctc
attctttctgattatgcaaagaaaaacaacgttaatacttctgcacttac
gcaatctgagattcgtgatataatacttggtgctgaaatagctccaccgt
cacagcagaggcaacagatagctgagattgagaaacagtcccgagagaca
aatcaggtaactgcacagacaacaaggacagttaatgtgcatggagatga
gctcatcgtcacaacaaccagtccgtatgagcaagcagcgtttgcatcga
agacagattggcgtgtcagggccatctctgctacgaacctgtatctccgt
gtcaaccacatttatgttaactcggatgatataaaggagactggctatac
ttacatcatgccaaagaacatattgaagaagttcatatgcatagcagatc
tacggacacaggttgcaggtttcctgtatgggctgagtccacaggataat
ccccaagtcaaggagatcagatgcatatccattccgccacagcatggaac
tcaccagatggtgactttgccatcgaatctcccagagcatgagttccttg
ctgacttggagccgttgggatggatgcatacccagccgaatgaagctcct
cagctatcacctcaggatttgacatcacatgctaaaattttggagaacaa
caagcagtgggatggtgagaagtgcatcattttgacctgcagcttcaccc
caggatcgtgctcgttgactgcgtacaaattgacaccaagtggttatgag
tgggcccgtggcaacaaggacaacgggagcaacccacaagggtacctccc
aactcactacgagaaggtccagatgcttctcagcgaccgcttccttggat
tctacatggttccggacaacgctccgtggaactacaacttcatgggagtc
aagcacgacccgctgatgaagtacagcatgaagctgggcacaccccgcga
cttctaccatgaggaccacaggccgacgcacttcctggagttcagcaaca
ttgaggagggcgaggtcgctgagggggacagggaggacaccttctcgtag
tcgtagccaccgtagcacgccccttcgcccctatgctagcatatcgaaac
ctgcaatgagatccgctcagttttggatggagatctctgtgatctgtaaa
ctttgacgtgacatgttgtatgttgttctccgtctctcaagactagtaat
actttgtgttgtaagcctccttcaaacacggtgctgtaaaagtgcatcat
gataacagttcaaacattttgcttggtggcatgtagatctcttcaaaaaa
aaaaaaaaaaaaaaaa
BLAST
BLAST Search