Query (optional)   in Class  

GrainGenes Sequence Report: NSFT03P2_Contig18535

[ Printable Version ]  [ Submit comment/correction ]

Sequence
NSFT03P2_Contig18535
Contigset
NSFT03P2 EST
Contig Members
BE490371
[ Show all 23 ]
Data at wEST
Contig annotation
Data Source
Chao, Shiaoman2003.01
DNA
cggcacgaggctcccttctcgcttcctcctcaccccgcactgccccaccg
cgccggccccgactccgactccgacactccccggcggcgcgcgctcgccg
agctcggtcgcgctgcggttcggatcccccggaggcgtgcggcttcggcg
cgggcgagggtcggcggcggtcgcgatggcatccgacgggcgcgtggagc
ggatcgcgtccagcatccgcgccatccccaacttccccaagccagggatt
ttgtttcaggacatcacaaccttgcttctcgatccgcaggcattccgtga
caccactgacctctttgtcgagcggtacaaggacaaagacataactgtag
ttgctggtgttgaagccagaggattcatttttggtcctcccattgcatta
gccataggtgcaaagtttgttccaataaggaagccgaaaaaattacctgg
tgaggtgatatcggaagaatattctctggaatatggcactgacaaaatcg
aaatgcacgtaggagctgtgcagcccaatgaccgagtccttattgtggat
gatctaattgccacagggggaaccctttgtgccgctgccaaacttattga
gcgtgttggagcaaaggtggttgagtgtgcctgtgttattgaactgccag
agctgaagggccgggacaagttgggggacatgccagtttttgtcctagtg
caggcagacgaatcagtatgaaacaagttgtgactcttgagttgttccaa
tgatgttccccttctggaactatactggaagcagcaaagatatccgttac
aatcttagctagttcctatctggagctgctcaataaaagtttcattttta
aatttgtccttctggaactgtttgggaatggagacttgattgttgttccc
tgtaatacgtggcttatttctgtcaaaaacagtgcaaattattcatgtca
atgaaggatgatagtctgtactgaagtttgtttcaaaaaaaaaaaaaaaa
aaaaaaaaa
BLAST
BLAST Search