Query (optional)   in Class  

GrainGenes Sequence Report: NSFT03P2_Contig18637

[ Printable Version ]  [ Submit comment/correction ]

Sequence
NSFT03P2_Contig18637
Contigset
NSFT03P2 EST
Contig Members
[ Hide all but 1 of 28 ]
CD453284
BE423832
BE492337
BE516058
BF473526
BG312657
BG314239
BG607525
BG607910
BI478999
BQ295201
BQ578916
BQ744279
BQ800714
BQ801343
BQ803162
BQ803215
BQ803898
BQ805675
BU099646
BU100724
BE406292
BE493657
BE515859
BF482511
BF292674
BG263706
BG314039
Data at wEST
Contig annotation
Data Source
Chao, Shiaoman2003.01
DNA
ggcacgaggcgccgccacacactccccgcagccaatcctccccaacccaa
gctcgcagccatgcctcccaagctcgacccgtcccagatcgtggaggtgt
atgtccgcgtcaccggcggggaggtcggcgctgcgtcgtccctggccccc
aagatcggtccgctcggtctctccccaaagaagatcggagaagacatcgc
caaggagacggccaaggactggaagggcctccgcgtcaccgtcaagctca
ccgtccagaatcgccaggccaaggtgtccgtcgtcccctccgccgcagcc
ctcgtcatcaaggcgctcaaggagcccgagagggaccgcaagaaggtcaa
gaacatcaagcacaacggcaacatcagcctcgacgacgtcatcgagatcg
ccaagatcatgaaggtccgctccatggccaaggagatggccggcaccgtc
aaggagatcctcggcacctgcgtcagcgtcggctgcaccgtcgacggcaa
ggaccccaaggatctgcagacggagatcgacgacggcgaggtggagatcc
ccgcttaagaaggcttggctttggggaggttgttgtgtgaggctgctgaa
gtagtttctcctatctagatgcttcctgatgcagttgagagaatggatgt
gatgtcttcacttgttctactcttgctgaagaagaaacttttgtcatgct
ttagtggttccattgtgagactatttttttactgctttaatgagtacctt
gtggaatcaatcaatgttattatggcagctagaatatcatatgttgagtt
ttgtcaatgatgttttgagcgtttcttatatattgttagttgctgcattt
gctttgctgtcttgtctctgaaagcagttgattgcagctgga
BLAST
BLAST Search