Query (optional)   in Class  

GrainGenes Sequence Report: NSFT03P2_Contig2305

[ Printable Version ]  [ Submit comment/correction ]

Sequence
NSFT03P2_Contig2305
Contigset
NSFT03P2 EST
Contig Members
BE490267
BQ161086
Data at wEST
Contig annotation
Data Source
Chao, Shiaoman2003.01
Probe
BE490267-2D
BE490267-2A
BE490267-2B
DNA
ttttttttttttttttttgacaagaacagagcacatttattcgatatgta
acatcatgcgctactgtaccaaactaccagcaactcctggccattcctgc
agtgcaacacgcacgcggccacgcatgcagcaggcaccgagacaaaacat
cacgctcgcggcctgctgctgttacagccggatcatggggaagagcttct
tccacgacttcctgctcctgtacgcggcgaacgctcgcaggtagtgcttc
ggggcgtcccccagcagcctagcgtcctcgcccagatccggctggtccgc
gccccagaaccgcgccgctcgccgcttccgccggacggcggccagcacgt
cgttccggttgcatatcccccacaccgtcaccttctgctggtggtaatcc
acctgaaccgagtgtatccctttgagattcgacagtgccttcttgatctt
cttctcgcagccgtaggagtagagcggcaccttcatctccacgtgctgcg
cctcgatcgtccccccggccagcacgatctgcagatcacccatcgtattc
tagctagctactagctctcaagaatagcagtgtgtcttcaagaactcgat
gtt
BLAST
BLAST Search